ID: 1117625353_1117625355

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1117625353 1117625355
Species Human (GRCh38) Human (GRCh38)
Location 14:57631530-57631552 14:57631549-57631571
Sequence CCTGTGCATTTGTATCAAAATTT ATTTGCCTGCCTCGTTATGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 372} {0: 1, 1: 1, 2: 1, 3: 6, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!