ID: 1117767039_1117767043

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1117767039 1117767043
Species Human (GRCh38) Human (GRCh38)
Location 14:59093969-59093991 14:59093995-59094017
Sequence CCAGGACCTTTCTCATCAATTGC GTTAATTAAATATTACCGCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!