ID: 1117776476_1117776496

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1117776476 1117776496
Species Human (GRCh38) Human (GRCh38)
Location 14:59189179-59189201 14:59189231-59189253
Sequence CCCGGCCCGGCGGCTCCGAGAGG GGCGGTGGCGACAGGGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 210} {0: 1, 1: 0, 2: 5, 3: 60, 4: 559}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!