ID: 1117784166_1117784173

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1117784166 1117784173
Species Human (GRCh38) Human (GRCh38)
Location 14:59265437-59265459 14:59265466-59265488
Sequence CCTGCCCCCCAAAGATCTGACAG AAGGAGATCCATTATGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 193} {0: 1, 1: 0, 2: 1, 3: 14, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!