ID: 1117786551_1117786557

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1117786551 1117786557
Species Human (GRCh38) Human (GRCh38)
Location 14:59291860-59291882 14:59291902-59291924
Sequence CCACATCCACTGAAAGGACTAAA ACTTCCCATTTAAGATCTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 239} {0: 1, 1: 0, 2: 0, 3: 9, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!