ID: 1117787781_1117787786

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1117787781 1117787786
Species Human (GRCh38) Human (GRCh38)
Location 14:59305009-59305031 14:59305034-59305056
Sequence CCTACTTTATGACATTCTGAAAG GGGTCTGGTAGCTACAAATGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 61, 3: 486, 4: 1147} {0: 1, 1: 0, 2: 0, 3: 11, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!