ID: 1117802637_1117802639

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1117802637 1117802639
Species Human (GRCh38) Human (GRCh38)
Location 14:59461046-59461068 14:59461082-59461104
Sequence CCACAAGTAAACTTGTTATGGCT AAGCCACAAGGTCCTTGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93} {0: 1, 1: 0, 2: 0, 3: 18, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!