ID: 1117824139_1117824141

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1117824139 1117824141
Species Human (GRCh38) Human (GRCh38)
Location 14:59683518-59683540 14:59683538-59683560
Sequence CCTAAGATCCATTCACTGTAGAA GAATTAAATGTCACAAATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 258} {0: 1, 1: 0, 2: 3, 3: 23, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!