ID: 1117896577_1117896579

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1117896577 1117896579
Species Human (GRCh38) Human (GRCh38)
Location 14:60493886-60493908 14:60493913-60493935
Sequence CCAAGAAGTGAGGGAAACTGGTG GGAACACTGTTAGTAGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 188} {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!