ID: 1117896714_1117896717

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1117896714 1117896717
Species Human (GRCh38) Human (GRCh38)
Location 14:60495100-60495122 14:60495137-60495159
Sequence CCTTTGGTAGAAAAAGCTTGGCC GGAACAGTCTCTCCCGAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 159} {0: 1, 1: 0, 2: 0, 3: 14, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!