ID: 1117920540_1117920553

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1117920540 1117920553
Species Human (GRCh38) Human (GRCh38)
Location 14:60722783-60722805 14:60722819-60722841
Sequence CCCGGCCGGCGCCGGCAGTCTCT GGCAGGGAGAGCTACGGTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133} {0: 1, 1: 0, 2: 0, 3: 63, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!