|
Left Crispr |
Right Crispr |
| Crispr ID |
1117922347 |
1117922353 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:60738495-60738517
|
14:60738511-60738533
|
| Sequence |
CCAGCCGCCTCGATCCTCCCAAA |
TCCCAAAGTGCTGGGATTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 4, 3: 50, 4: 339} |
{0: 284556, 1: 262309, 2: 153276, 3: 130613, 4: 189623} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|