ID: 1117976503_1117976508

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1117976503 1117976508
Species Human (GRCh38) Human (GRCh38)
Location 14:61302369-61302391 14:61302397-61302419
Sequence CCTGGGTCCGGGTTGGGGGAAAG GGATCCACCATCTCATCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 199} {0: 1, 1: 2, 2: 4, 3: 20, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!