ID: 1117980286_1117980289

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1117980286 1117980289
Species Human (GRCh38) Human (GRCh38)
Location 14:61336170-61336192 14:61336214-61336236
Sequence CCAGCCCTTTTCTGAAGTTAACT TTTACATAGAATTCAAGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 412} {0: 1, 1: 0, 2: 3, 3: 39, 4: 408}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!