ID: 1117990581_1117990584

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1117990581 1117990584
Species Human (GRCh38) Human (GRCh38)
Location 14:61429097-61429119 14:61429118-61429140
Sequence CCTAGCATTTTGCATGAGTTTCT CTGTTGGTCTGGAGAATAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 283} {0: 1, 1: 0, 2: 0, 3: 19, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!