ID: 1118024083_1118024096

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1118024083 1118024096
Species Human (GRCh38) Human (GRCh38)
Location 14:61751209-61751231 14:61751252-61751274
Sequence CCGCGGCCCCGGCCGTGGGCTCC CGACTTTCGTGTACGCTGTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!