|
Left Crispr |
Right Crispr |
| Crispr ID |
1118027149 |
1118027155 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:61781116-61781138
|
14:61781157-61781179
|
| Sequence |
CCTCCATGGATACTGAGAGACAG |
TAAGAATTGTTGGCCGGGTGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 5, 2: 31, 3: 117, 4: 470} |
{0: 1, 1: 9, 2: 70, 3: 503, 4: 2221} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|