ID: 1118054416_1118054424

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1118054416 1118054424
Species Human (GRCh38) Human (GRCh38)
Location 14:62064579-62064601 14:62064611-62064633
Sequence CCATTTTGTCCAGAATTTAAGAA ATGGGGAAACAGATGGTAGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 347} {0: 1, 1: 0, 2: 4, 3: 39, 4: 438}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!