ID: 1118073230_1118073242

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1118073230 1118073242
Species Human (GRCh38) Human (GRCh38)
Location 14:62269211-62269233 14:62269260-62269282
Sequence CCCCTCCACCCTCTATCCTTATC AGTGGTTCAAAAATAGTAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 15, 3: 104, 4: 530}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!