ID: 1118073231_1118073238

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1118073231 1118073238
Species Human (GRCh38) Human (GRCh38)
Location 14:62269212-62269234 14:62269232-62269254
Sequence CCCTCCACCCTCTATCCTTATCT TCTATGGTGTCAGTTACCCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 58, 4: 670} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!