ID: 1118075493_1118075497

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1118075493 1118075497
Species Human (GRCh38) Human (GRCh38)
Location 14:62293815-62293837 14:62293861-62293883
Sequence CCAGTTGAGAATGTCTTTATTCT GGCCAGGTAGAGAATCTTGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!