ID: 1118075494_1118075497

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1118075494 1118075497
Species Human (GRCh38) Human (GRCh38)
Location 14:62293840-62293862 14:62293861-62293883
Sequence CCTCACAATGATTAATTTCTTGG GGCCAGGTAGAGAATCTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 187} {0: 1, 1: 0, 2: 1, 3: 13, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!