ID: 1118081087_1118081091

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1118081087 1118081091
Species Human (GRCh38) Human (GRCh38)
Location 14:62361673-62361695 14:62361688-62361710
Sequence CCACCATGTGGCCCTGGTGGCAT GGTGGCATCCTCATTCTCTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!