ID: 1118117907_1118117915

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1118117907 1118117915
Species Human (GRCh38) Human (GRCh38)
Location 14:62802373-62802395 14:62802426-62802448
Sequence CCTGACACCACAAAGCAGAGGGC GTCCCCGGGAGCACAGTGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 241} {0: 1, 1: 0, 2: 1, 3: 17, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!