ID: 1118162958_1118162970

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1118162958 1118162970
Species Human (GRCh38) Human (GRCh38)
Location 14:63309443-63309465 14:63309485-63309507
Sequence CCCCCATATCCCTGTCTGAACCC CACACTCCACCAATTCCTCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!