ID: 1118168064_1118168072

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1118168064 1118168072
Species Human (GRCh38) Human (GRCh38)
Location 14:63357500-63357522 14:63357552-63357574
Sequence CCATGTTAGCCAGGATGGTCAGA AGTTGGACAAACACTATCAGGGG
Strand - +
Off-target summary {0: 11, 1: 111, 2: 10363, 3: 64363, 4: 95791} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!