ID: 1118182006_1118182009

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1118182006 1118182009
Species Human (GRCh38) Human (GRCh38)
Location 14:63503150-63503172 14:63503168-63503190
Sequence CCATTTTTTTTTTAACTACTGTA CTGTATGTACAGAGGGATTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 167, 4: 1488} {0: 1, 1: 0, 2: 0, 3: 18, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!