ID: 1118183124_1118183125

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1118183124 1118183125
Species Human (GRCh38) Human (GRCh38)
Location 14:63513424-63513446 14:63513442-63513464
Sequence CCACTCACTAAGTGTGCTTCTCA TCTCATGTTACATAAAACTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 129} {0: 1, 1: 4, 2: 7, 3: 25, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!