ID: 1118191072_1118191074

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1118191072 1118191074
Species Human (GRCh38) Human (GRCh38)
Location 14:63580877-63580899 14:63580903-63580925
Sequence CCATCAGAGGGCTTCAGTGAGCC TGTGCAGCAAGCTAGACAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!