|
Left Crispr |
Right Crispr |
| Crispr ID |
1118195319 |
1118195322 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:63620246-63620268
|
14:63620269-63620291
|
| Sequence |
CCTCAGCCTTAAAAAAGAACAAA |
ATCCTGTCATTTGTGAAACAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 19, 3: 148, 4: 1360} |
{0: 1, 1: 6, 2: 24, 3: 81, 4: 335} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|