ID: 1118210048_1118210051

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1118210048 1118210051
Species Human (GRCh38) Human (GRCh38)
Location 14:63757551-63757573 14:63757601-63757623
Sequence CCCTCTTTCTGTTGCTTACACAG AAATTCTAGACAACAGCTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 402} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!