ID: 1118227949_1118227956

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1118227949 1118227956
Species Human (GRCh38) Human (GRCh38)
Location 14:63920681-63920703 14:63920714-63920736
Sequence CCGAGAAAGAATGGTGTCCTGAT CCGTGGAGATGGAGAGAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 189} {0: 1, 1: 2, 2: 10, 3: 104, 4: 650}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!