ID: 1118229472_1118229477

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1118229472 1118229477
Species Human (GRCh38) Human (GRCh38)
Location 14:63934409-63934431 14:63934454-63934476
Sequence CCGATTATGTGCTCCATTTGAAC TGCTGCCACTTTTCTCAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 226} {0: 1, 1: 0, 2: 0, 3: 19, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!