ID: 1118232867_1118232871

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1118232867 1118232871
Species Human (GRCh38) Human (GRCh38)
Location 14:63970185-63970207 14:63970237-63970259
Sequence CCAATCCCTGTCTTTTTTTTTTG AGAGTGCACCAGCACAATCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 29, 3: 575, 4: 5083} {0: 1, 1: 1, 2: 64, 3: 814, 4: 6679}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!