|
Left Crispr |
Right Crispr |
| Crispr ID |
1118253650 |
1118253655 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:64185762-64185784
|
14:64185777-64185799
|
| Sequence |
CCGTCCACCTTGGGCTTCCAAAG |
TTCCAAAGTGCTGGGATTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 76, 2: 2604, 3: 29993, 4: 87151} |
{0: 9594, 1: 299194, 2: 262940, 3: 149017, 4: 131705} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|