ID: 1118261252_1118261255

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1118261252 1118261255
Species Human (GRCh38) Human (GRCh38)
Location 14:64248895-64248917 14:64248908-64248930
Sequence CCTGCCTGAACCTCTTCTAAGCT CTTCTAAGCTGCCCAAAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 185} {0: 1, 1: 0, 2: 0, 3: 13, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!