ID: 1118261409_1118261422

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1118261409 1118261422
Species Human (GRCh38) Human (GRCh38)
Location 14:64250708-64250730 14:64250759-64250781
Sequence CCCTCCTCCTTCCCCGAACTCAG GGAAGAGCCTCTGACACCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 505} {0: 1, 1: 0, 2: 0, 3: 17, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!