|
Left Crispr |
Right Crispr |
| Crispr ID |
1118264524 |
1118264525 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:64282062-64282084
|
14:64282081-64282103
|
| Sequence |
CCAGGCACAGTGTTCATCACGTC |
CGTCTGTAATCCCAGCACTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 2, 3: 3, 4: 119} |
{0: 4613, 1: 136929, 2: 281071, 3: 222057, 4: 151982} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|