|
Left Crispr |
Right Crispr |
| Crispr ID |
1118264524 |
1118264531 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:64282062-64282084
|
14:64282095-64282117
|
| Sequence |
CCAGGCACAGTGTTCATCACGTC |
GCACTTTGGGAGGCCAAGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 2, 3: 3, 4: 119} |
{0: 56485, 1: 171609, 2: 226607, 3: 184242, 4: 115036} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|