ID: 1118265788_1118265792

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1118265788 1118265792
Species Human (GRCh38) Human (GRCh38)
Location 14:64294128-64294150 14:64294150-64294172
Sequence CCTGTTGAGGAAAGCGAGCGCAC CCTCCTGCAGCTCAGGCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31} {0: 1, 1: 1, 2: 1, 3: 90, 4: 641}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
-1 14:64294128-64294150 CCTGTTGAGGAAAGCGAGCGCAC - 14:64294150-64294172 CCTCCTGCAGCTCAGGCTCCGGG +