|
Left Crispr |
Right Crispr |
| Crispr ID |
1118294569 |
1118294575 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:64557385-64557407
|
14:64557408-64557430
|
| Sequence |
CCAATATATAAAATAAGAAGAAG |
AAGGGGAAAGAGAAGGAGAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 12, 3: 100, 4: 1123} |
{0: 2, 1: 24, 2: 206, 3: 1091, 4: 4687} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|