ID: 1118297188_1118297194

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1118297188 1118297194
Species Human (GRCh38) Human (GRCh38)
Location 14:64581371-64581393 14:64581391-64581413
Sequence CCCTTATCTGAGGTCTACATGCC GCCAGTGGACCCATTTGGTGGGG
Strand - +
Off-target summary {0: 9, 1: 27, 2: 52, 3: 83, 4: 146} {0: 2, 1: 4, 2: 27, 3: 51, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!