|
Left Crispr |
Right Crispr |
Crispr ID |
1118297188 |
1118297194 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
14:64581371-64581393
|
14:64581391-64581413
|
Sequence |
CCCTTATCTGAGGTCTACATGCC |
GCCAGTGGACCCATTTGGTGGGG |
Strand |
- |
+ |
Off-target summary |
{0: 9, 1: 27, 2: 52, 3: 83, 4: 146} |
{0: 2, 1: 4, 2: 27, 3: 51, 4: 136} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|