ID: 1118317211_1118317228

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1118317211 1118317228
Species Human (GRCh38) Human (GRCh38)
Location 14:64732649-64732671 14:64732698-64732720
Sequence CCTGAAGCTCCCAGCTGGAAGAT CTGGAGCTGGGTGGGTATAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 177} {0: 1, 1: 0, 2: 3, 3: 33, 4: 474}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!