ID: 1118328493_1118328497

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1118328493 1118328497
Species Human (GRCh38) Human (GRCh38)
Location 14:64797659-64797681 14:64797703-64797725
Sequence CCATTCACTGTGTCCTTATCGGG ATGCATAACGGAAAATGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 110} {0: 1, 1: 0, 2: 0, 3: 6, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!