ID: 1118329525_1118329534

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1118329525 1118329534
Species Human (GRCh38) Human (GRCh38)
Location 14:64804682-64804704 14:64804710-64804732
Sequence CCCAAAGTCAGGAGCTCTGCATG TGGGAGAAGCATGAAGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 265} {0: 1, 1: 0, 2: 5, 3: 39, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!