ID: 1118335033_1118335036

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1118335033 1118335036
Species Human (GRCh38) Human (GRCh38)
Location 14:64846180-64846202 14:64846222-64846244
Sequence CCCGATCTCAACAACAGAACAAA ACTCTGCCCCAGAAGTAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 158, 4: 1761} {0: 1, 1: 0, 2: 1, 3: 11, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!