ID: 1118348068_1118348073

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1118348068 1118348073
Species Human (GRCh38) Human (GRCh38)
Location 14:64954207-64954229 14:64954230-64954252
Sequence CCATTCTTCCATGTGTGCAGAGA AAGAGTGAAGAGAAGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 357} {0: 1, 1: 2, 2: 32, 3: 367, 4: 3323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!