ID: 1118351082_1118351090

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1118351082 1118351090
Species Human (GRCh38) Human (GRCh38)
Location 14:64972614-64972636 14:64972643-64972665
Sequence CCCAAGTCTGGCGCCGGTAATTC CCGTGGCACCCTGCATCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 21} {0: 1, 1: 1, 2: 1, 3: 10, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!