ID: 1118375765_1118375771

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1118375765 1118375771
Species Human (GRCh38) Human (GRCh38)
Location 14:65175741-65175763 14:65175763-65175785
Sequence CCTGGCCTCAAGTGATCCTCCCA ATCTTGGCCTCCCAAAGTGCTGG
Strand - +
Off-target summary {0: 1920, 1: 16397, 2: 53809, 3: 123827, 4: 185367} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!