ID: 1118375770_1118375776

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1118375770 1118375776
Species Human (GRCh38) Human (GRCh38)
Location 14:65175761-65175783 14:65175782-65175804
Sequence CCATCTTGGCCTCCCAAAGTGCT CTGGGATTACAGATGAGCCACGG
Strand - +
Off-target summary {0: 3853, 1: 66063, 2: 153594, 3: 157369, 4: 93226} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!